Men with the haplogroup G marker moved into Europe in Neolithic times. Nonetheless, coalescent times provide a valuable/informative relative metric for estimating the time of lineage formation. Unresolved G2a-P15* lineages occur across a wide area extending from the Near/Middle East to the Balkans and Western Europe in the west, the Caucasus (especially the South Caucasus) in the north and Pakistan in the east. G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa. But a high percentage of U1 men belong to its two subclades, G-L13/S13 and Z1266 (G2a3b1a1b). (This followed the publication of: Haplogroup K2b (M1221/P331/PF5911) is also known as Haplogroup MPS. IK thanks the Russian Foundation for Basic Research for grant 08-06-97011 and the Grant of the President of the Russian Federation of state support for young Russian scientists MK-488.2006.4. Another frequent sub-clade of the G2a3-M485 lineage is G2a3a-M406 (Figure 2e). The mutation is found on the Y chromosome at 10595022 and is a change from G to C. G-L30 (also G-PF3267, G-S126 or G-U8; G2a2b, previously G2a3) Battaglia V, Fornarino S, Al-Zahery N et al. Origin. The Madjar and Argyn tribes (or clans) of Kazakhstan were found to possess the highest levels of G-M201 among any modern ethnic group. Kivisild T, Rootsi S, Metspalu M et al. Eur J Hum Genet 2008; 16: 374386. Phylogenetic relationships of studied binary markers within haplogroup G in wider context of M89-defined clade. We genotyped binary markers following PCR amplification, by either Denaturing High Performance Liquid Chromatography, RFLP analysis, Taqman assay (Applied Biosystems, Foster City, CA, USA) or direct Sanger sequencing methodology. Reduced genetic structure of the Iberian peninsula revealed by Y-chromosome analysis: implications for population demography. The Sea Peoples, from cuneiform tablets to carbon dating. Almost all haplogroup G1 persons have the value of 12 at short tandem repeat (STR) marker DYS392 and all will have the M285 or M342 SNP mutation which characterizes this group. Haplogroup S, as of 2017, is also known as K2b1a. The G-L13 subclade is most common in north central Europe, and G-Z1266 is most common in the western Caucasus Mountains. Haplogroup G (Y-DNA) In human genetics, Haplogroup G (M201) is a Y-chromosome haplogroup. PubMed [42] The technical specifications of M201 are given as: refSNPid is rs2032636..Y chromosome location of 13536923.forward primer is tatgcatttgttgagtatatgtc..reverse primer is gttctgaatgaaagttcaaacg..the mutation involves a change from G to T. A number of SNPs have been identified with seemingly the same coverage in the population as M201. The results were analyzed using the ABI PRISM program GeneMapper 4.0 (Applied Biosystems). These Neolithic European were descendants of Neolithic farmers from Anatolia, among some of the earliest peoples in the world to practice agriculture. Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68]. Haplogroup G2a1 (also known as G-FGC753 and previously as G-L293) and its subclades represent the majority of haplogroup G samples in some parts of the Caucasus Mountains area. It is a branch of Haplogroup F (M89), and is theorized to have originated, according to the latest thinking, in the Near East or Southern Asia, likely in the region that is now northern India, Pakistan, and Afghanistan. In Lebanon, however, G accounts for 6.5% of the population and in Iran to around 10%. Categories have alternating letters and numbers. Semino et al. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. See more. Moreover, these general frequencies mostly consist of two notable lineages. L141 persons who do not belong to any L141 subclade so far have the value of 11 at STR marker DYS490 a finding rare in other G categories. The corresponding coalescent estimate for M377 is 5600 years ago (Supplementary Table S4). Sengupta S, Zhivotovsky LA, King R et al. The new phylogenetic and phylogeographic information provides additional insights into the demographic history and migratory events in Eurasia involving hg G. The present study comprises data from 98 populations totaling 17577 individuals, of which 1472 were members of hg G. The haplogroup frequency data are presented in Supplementary Table S1. The phylogeny obtained for haplogroup Q-M378 comprising 5.2% of the Ashkenazi paternal variation 24, shows a similar pattern to that observed for haplogroup G-M377 (Supplemental Figure S5). SR thanks the Estonian Science Foundation for grant 7445 and M Metspalu for grant 8973. Kayser M, Caglia A, Corach D et al. The Morans I coefficient was calculated using the PASSAGE software v.1.1 (Phoenix, AZ, USA) with binary weight matrix, nine distance classes and random distribution assumption. Sims LM, Garvey D, Ballantyne J : Improved resolution haplogroup G phylogeny in the Y chromosome, revealed by a set of newly characterized SNPs. The Etruscans: a population-genetic study. Haplogroup G2a2b is a rare group today in Europe. Haplogroup K2a (M2308) and its primary subclade K-M2313 were separated from Haplogroup NO (F549) in 2016. Gene pool structure of Eastern Ukrainians as inferred from the Y-chromosome haplogroups. Hammer MF, Behar DM, Karafet TM et al. The Caucasus are today mainly the countries of Georgia, Armenia, Azerbaijan and southwestern Russia. All G-M377 men tested so far also have a rare null value for the DYS425 marker, (a missing "T" allele of the DYS371 palindromic STR), the result of a RecLOH event, a finding not yet seen among most other G haplotypes. It has an extremely low frequency in modern populations, except (i) Iran and its western neighbors, and (ii) a region straddling south Central Siberia (Russia) and northern Kazakhstan. So far the men positive for this have had Irish, English, Dutch, Lebanese and/or Turkish (Armenian surname) ancestry. The frequency data were converted into isofrequency maps using the Surfer software (version 8, Golden Software, Inc., Golden, CO, USA), following the kriging algorithm using advanced options to use bodies of waters as breaklines. It encompasses a small group of Hispanic men who also so far all have the odd value of 13,21 at the YCA marker. In addition, there are multiple other SNPs thought to have the same coverage as M201. The mutation involves a change from C to T.[citation needed] L223 is found on the Y chromosome at rs13304806. Nonetheless, our approach using high-resolution phylogenetic relationships as well as their phylogeography to infer the possible origin of a genetic variant provides a more plausible deduction than simply the region of highest frequency. Haplogroup H The general frequency pattern of hg G overall (Figure 2a) shows that the spread of hg G extends over an area from southern Europe to the Near/Middle East and the Caucasus, but then decreases rapidly toward southern and Central Asia. ISSN 1476-5438 (online) The SNP L497 encompasses these men, but most G-L497 men belong to its subclade G-Z725, also known as G-DYS388=13. In the Russian North Caucasus the Kabardinian and Ossetian populations are also notable for high rates of G-M201. These two reported Pakistani G-M377 haplotypes are quite divergent from the Ashkenazi Jewish clade, and therefore do not at all indicate a recent common origin. Although not exceeding 3% frequency overall, haplogroup G1-M285 reflects a branching event that is phylogenetically equivalent to the more widespread companion G2-P287 branch in the sense that both branches coalesce directly to the root of G-M201. Mol Phylogenet Evol 2007; 44: 228239. Genomics 1999; 57: 433437. It is a branch of Haplogroup F (M89), and is theorized to have originated, according to the latest thinking, in the Near East or Southern Asia, likely in the region that is now northern India, Pakistan, and Afghanistan. An assessment of the Y-chromosome phylogeography-based proposal that the spread of G2a-L497 chromosomes originated from Central Europe could be achieved by typing this SNP in the Holocene period human remains from Germany31 as well as those from France and Spain.45, 46 Certainly, Y chromosome represents only a small part of human genome and any population-level interpretation of gene flow in this region would have to be supported by genome-wide evidence. A subset of 693 samples was typed for short tandem repeats of Y-chromosome (Y-STRs) using the 17 STR markers in the Applied Biosystems AmpFlSTR Yfiler Kit according to manufacturer recommendations. Luis JR, Rowold DJ, Regueiro M et al. A separate study on the Argyns found that 71% of males belong to G1. You are using a browser version with limited support for CSS. The DYS391 marker has mostly a value of 10, but sometimes 11, in G2a2b1 persons, and DYS392 is almost always 11. The highest frequencies of haplogroup G appear in the Caucasus region; however it also shows significant frequencies in the Mediterranean areas and the Middle East [69,70]. It is one of two branches of the parent haplogroup GHIJK, the other being HIJK . While acknowledging that the inference of the age and geographic source of dispersals of Y chromosome haplogroups from the frequency and STR diversity data can be approximate at best, we speculate that this lineage could potentially be associated with the Linearbandkeramik (LBK) culture of Central Europe, as its highest frequency (3.45.1%) and Td estimate (Supplementary Table S4) of 108703029 years ago occur there. The International Society of Genetic Genealogy (ISOGG) maintains the most up-to-date consensus version of haplogroup categories. The members of G-PF3359 are probably smaller in number than men included in G-P303, but only a small amount of testing has occurred for the relevant mutations. Y chromosome sequence variation and the history of human populations. The 96 populations were collapsed into 50 regionally defined populations by excluding populations where the total G count was less than n=5. Excavating Y-chromosome haplotype strata in Anatolia. Circles represent microsatellite haplotypes, the areas of the circles and sectors are proportional to haplotype frequency (smallest circle corresponds to one individual) and the geographic area is indicated by color. The coming of the Greeks to Provence and Corsica: Y-chromosome models of archaic Greek colonization of the western Mediterranean. Pericic M, Lauc LB, Klaric IM, Janicijevic B, Rudan P : Review of croatian genetic heritage as revealed by mitochondrial DNA and Y chromosomal lineages. Important caveats to consider include the fact that Td is sensitive to authentic rare outlier alleles and that multiple founders during population formation will inflate the age estimate of the event. The most probably region of the initial phase of G-M201 is estimated to be in Anatolia, Armenia or western Iran. Haak W, Balanovsky O, Sanchez JJ et al. The presence of M527 in Provence, southern Italy and Ukraine may reflect subsequent Greek maritime Iron Age colonization events16 and perhaps, given its appearance among the Druze and Palestinians, even episodes associated with the enigmatic marauding Sea Peoples.42. In addition, we introduce five new markers: M426, M461, M485, M527 and M547 (Supplementary Table S2). Anyone you share the following link with will be able to read this content: Sorry, a shareable link is not currently available for this article. The phylogenetic relationships of the various sub-haplogroups investigated are shown in Figure 1. No clinal patterns were detected suggesting that the distributions are rather indicative of isolation by distance and demographic complexities. The Genetic Legacy of Paleolithic Homo sapiens sapiens in Extant Europeans: A Y Chromosome Perspective. Although progress has been recently made in resolving the haplogroup G phylogeny, a comprehensive survey of the geographic distribution patterns of the significant sub-clades of this haplogroup has not been conducted yet. Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood. [26][27] Among the Druze mostly residents of Israel 10% were found to be haplogroup G.[28], Around 10% of Jewish males are Haplogroup G.[citation needed], In Africa, haplogroup G is rarely found in sub-Saharan Africa or south of the horn of Africa among native populations. International Society of Genetic Genealogy (ISOGG; 2015), "Punctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequences", https://en.wikipedia.org/w/index.php?title=Haplogroup_G-M201&oldid=1139571590, Articles with dead external links from January 2020, Articles with permanently dead external links, All articles with bare URLs for citations, Articles with bare URLs for citations from April 2022, Articles with spreadsheet file bare URLs for citations, Short description is different from Wikidata, Articles with self-published sources from October 2020, Articles with unsourced statements from November 2017, Articles with unsourced statements from September 2022, Articles with unsourced statements from July 2017, Wikipedia articles in need of updating from February 2021, All Wikipedia articles in need of updating, Creative Commons Attribution-ShareAlike License 3.0, M201, PF2957, L116, L154, L204, L240, L269, L402, L520, L521, L522, L523, L605, L769, L770, L836, L837, M201, P257/U6, Page94/U17, U2, U3, U7, U12, U20, U21, U23, U33, Other males purported to be members of Haplogroup G include: German-American pioneer and soldier, This page was last edited on 15 February 2023, at 20:17. contracts here. Zhivotovsky LA, Underhill PA, Cinnioglu C et al. Balanovsky O, Rootsi S, Pshenichnov A et al. Notably no basal G-M201*, Page94*(xM285, P287) chromosomes were detected in our data set. Here we address this issue with a phylogeographic overview of the distribution of informative G sub-clades from South/Mediterranean Europe, Near/Middle East, the Caucasus and Central/South Asia. Then we applied a 10% overall hg G frequency threshold and the additional specification that both haplogroup G1 and G2 lineages also be present. The origin of haplogroup G is controversial. Am J Hum Genet 2004; 74: 788788. Semino O, Magri C, Benuzzi G et al. Thus inferences regarding migratory histories must be viewed cautiously, as diversities may have changed over the time spans discussed. Although hg G1 frequency distribution, overall, extends further eastward as far as Central Asian Kazakhs (present even among Altaian Kazakhs38 with identical STR haplotypes compared with the main Kazakh population), it is virtually absent in Europe. P15 was identified at the University of Arizona and became widely known by 2002. Peter A Underhill. Haplogroup A0-T is also known as A-L1085 (and previously as A0'1'2'3'4). [21] In a study of 936 Indians, haplogroup G made up less than 1% of the sample and was completely absent in the tested Northwestern Indian population. King RJ, Ozcan SS, Carter T et al. For the multi-copy STR DYS389I,II the DYS389b value was DYS389I subtracted from DYS389II. (a) Principal component analysis by population. We attempted to localize the potential geographic origin of . Y-chromosomal diversity in Lebanon is structured by recent historical events. Although M527 frequency (Supplementary Table S1) is relatively low (16%), its phylogeographic distribution in regions such as southern Italy, Ukraine and the Levant (Druze and Palestinians) often coincides with areas associated with the Neolithic and post-Neolithic expansions into the Greek Aegean beginning approximately 7000 years ago.41 The expansion time (Td) of M527 is 71002300 years ago and is consistent with a Middle to Late Neolithic expansion of M527 in the Aegean. Achilli A, Olivieri A, Pala M et al. Chromosome Y microsatellites: population genetic and evolutionary aspects. There were only a few G categories until 2008 when major revisions to categories were made. Furthermore, markers Page94, U5, U8 and L30 were typed in contextually appropriate samples to establish the position of the five new markers within the phylogeny. In Europeexcept in Italy G2a2b1 constitutes less than 20% of G samples. Principal component analysis based on G sub-haplogroup frequencies was performed using the freeware POPSTR program (http://harpending.humanevo.utah.edu/popstr/). MH and MHS are thankful to the National Institute for Genetic Engineering and Biotechnology, Tehran, Iran, and the National Research Institute for Science policy, Tehran, Iran, for providing the samples. Evolutionary Biology Group, Estonian Biocentre, Tartu, Estonia, Siiri Rootsi,Mari Jrve,Ildus Kutuev,Krt Varendi,Hovhannes Sahakyan,Doron M Behar,Alena Kushniarevich&Richard Villems, Department of Psychiatry and Behavioral Sciences, Stanford University School of Medicine, Stanford, CA, USA, Department of Evolutionary Biology, Institute of Molecular and Cell Biology, University of Tartu, Tartu, Estonia, Institute of Biochemistry and Genetics, Ufa Research Center, Russian Academy of Sciences, Ufa, Russia, Ildus Kutuev,Elza K Khusnutdinova&Rita Khusainova, Departamento de Gentica, Facultad de Biologa, Universidad de La Laguna, Tenerife, Spain, Human Genetics Group, Institute of Molecular Biology, Academy of Sciences of Armenia, Yerevan, Armenia, Hovhannes Sahakyan,Levon Yepiskoposyan&Ardeshir Bahmanimehr, Research Centre for Medical Genetics, Russian Academy of Medical Sciences, Moscow, Russia, Institute for Anthropological Research, Zagreb, Croatia, Immunology department, Allergy Research Center, Shiraz University of Medical Sciences, Shiraz, Iran, Department of Human and Molecular Genetics, College of Medicine, Florida International University, Miami, FL, USA, Dipartimento di Biologia e Biotecnologie L. It is a child of haplogroup M12'G. It was likely born in the East Asia around 32,000 years ago. [36], G-PF3359 (or G2a2b2b; previously G2a3b2) was known prior to 2013 as G-L177. Rosser ZH, Zerjal T, Hurles ME et al. Among Jews in Israel drawn from many areas of the world, G-M377 constituted 3.7% in one study. There are distinctive Ashkenazi Jewish and Kazakh subclades based on STR marker value combinations. Considering these issues, we acknowledge that the variance of the age estimates may be underestimated. 25 and 0.00069 denote the assumed average generation time in years and the effective mutation rate, respectively, and 1000 is used to convert the result of the equation (into thousands of years). A clade of closely related Ashkenazi Jews represent virtually all G2b persons, with just three other G2b haplotypes having been reported so far: one Turk from Kars in northeast Turkey near Armenia, one Pashtun, and one Burusho in Pakistan. The Caucasus as an asymmetric semipermeable barrier to ancient human migrations. In Wales, a distinctive G2a3b1 type (DYS388=13 and DYS594=11) dominates there and pushes the G percentage of the population higher than in England. and JavaScript. Am J Hum Genet 2012; 90: 573. Ann Hum Genet 2004; 68: 588599. In Russia, Ukraine and Central Asia, members of various ethnic minorities and/or residents in particular localities possess G-M201 at its highest levels in the world even though the average rate at the national level is about 1% or less. G1-M285, previously described in the Iranian population . This group was created for the folks who's paternal Y-DNA reflects they belong to haplogroup G2a (G-P15). (Previously the name Haplogroup S was assigned to K2b1a4. The L141 mutation involves an insertion.[35]. L223 is found on the Y chromosome at rs810801 and 6405148 with a mutation from C to G. L223 was first identified in samples at 23andMe in 2009 but proved problematic as an individual test, the first successful results being reported at Family Tree DNA in late 2011 under its assigned L223 label. Its estimated Td of 120953000 years ago suggests considerable antiquity allowing time to accumulate STR diversity and also to disperse relatively widely. In descending order, G-P303 is additionally a branch of G2 (P287), G2a (P15), G2a2, G2a2b, G2a2b2, and finally G2a2b2a. G-L91 would seem to encompass a significant proportion of men belonging to G. L91 is found so far in scattered parts of Europe and North Africa and in Armenia. Herein . The highest frequency values for P303 are detected in populations from Caucasus region, being especially high among South Caucasian Abkhazians (24%) and among Northwest (NW) Caucasian Adyghe and Cherkessians39.7% and 36.5%, respectively. The highest reported concentration of G1 and its subclades in a single country is in Iran, with next most frequent concentrations in neighboring countries to the west. Here we present the haplogroup frequency distribution and STR variation of 16 informative G sub-clades by evaluating 1472 haplogroup G chromosomes belonging to 98 populations ranging from Europe to Pakistan. Cadenas AM, Zhivotovsky LA, Cavalli-Sforza LL, Underhill PA, Herrera RJ : Y-chromosome diversity characterizes the Gulf of Oman. Russ J Genet 2004; 40: 326331. The identities of the specific 19 loci that define the STR haplotypes are reported in Supplementary Table S3 and Figure 4 legend. The discovery of new SNPs can result in assignment of new names to haplogroup categories. Y-chromosome lineages from Portugal, Madeira and Acores record elements of Sephardim and Berber ancestry. [4], Two scholarly papers have also suggested an origin in the Middle East, while differing on the date. [25], In the Middle East, haplogroup G accounts for about 3% of the population in almost all areas. In contrast to G1, the absolute majority of hg G samples belonged to G2-P287-related sub-clades, with the vast majority of them being associated with G2a-P15-related lineages. Hg G is most common in the Caucasus with a maximum frequency exceeding 70% in North Ossetians,2, 3 decreasing to 13% in Iran4 and then rapidly dissipating further eastward. The Network 4.6.0.0 (Fluxus-Engineering) program was used (median-joining algorithm and the post-processing option). The haplogroup G mutation developed about 21,000 to 14,000 years ago. Digora, North Ossetia has the highest known concentration of G in a single city, as 74% of the tested men were G.[14] Haplogroup G is found as far east as northern China in small percentages where G can reach more substantial percentages in minority groups such as the Uyghurs. Am J Hum Genet 2003; 72: 313332. Ancient DNA reveals male diffusion through the Neolithic Mediterranean route. Dulik MC, Zhadanov SI, Osipova LP et al. It is notable that tzi the 5300-year-old Alpine mummy was derived for the L91 SNP and his autosomal affinity was nearest to modern Sardinians.28, The G2a2-M286 lineage is very rare, so far detected only in some individuals in Anatolia and the South Caucasus. G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa . PLoS One 2009; 4: e5792. Provided by the Springer Nature SharedIt content-sharing initiative, European Journal of Human Genetics (2021), European Journal of Human Genetics (2020), European Journal of Human Genetics (Eur J Hum Genet) Mitochondrial DNA and Y Chromosome Variation Provides Evidence for a Recent Common Ancestry between Native Americans and Indigenous Altaians. Until 2008, new G SNPs were reported from labs at the University of Arizona (P designations), Stanford University (M designations) or the University of Central Florida (U designations). Distribution. Although the present-day frequency of G1 is low across its spread zone, the expansion time estimate (Supplementary Table S4) of 192716158 years attests to considerable antiquity. Whatever the date or specific place of origin, part of the G family put down roots predominantly in the area south and east of the Caucasus mountains. The British samples have inconsistent double values for STR marker DYS19 in many cases. Am J Hum Genet 2008; 82: 873882. Princeton: Princeton University Press, 1994. [29][30][31] 3% of North African Berbers were found to be haplogroup G.[32] 2% of Arab Moroccans and 0.8% of Berber Moroccans were likewise found to be G.[33]. Included within G-L91 are some men with double values for STR marker DYS19, but there are also G2a2 men with this finding who are not L91+. PLoS One 2011; 6: e20232. Mol Biol Evol 2006; 23: 22682270. Haplogroup L2b1a is a branch on the maternal tree of human kind. Nei M : Molecular Evolutionary Genetics. Int J Legal Med 1997; 110: 134149. Am J Hum Genet 2004; 74: 694704. The Levant versus the Horn of Africa: evidence for bidirectional corridors of human migrations. Thank you for visiting nature.com. It was then learned that several subclades belong under L223, including: G-L91 was identified in 2009. The second component, influenced by the relatively high presence of M377, separates Ashkenazi Jews from other populations (Figure 3a). Nat Commun 2012; 3. de Knijff P, Kayser M, Caglia A et al. But unusual values or unusual value combinations found at short tandem repeat markers (STRs) can also provide the basis of additional taxonomisation. Members of this group have been found in Europe and the Middle East.[3]. If a sample meets the criteria indicated for these three markers, it is likely the sample is G2a2b1. Furthermore, the U1-specific sub-clade M527 is most pronounced among Ukrainians and Anatolian Greeks. The frequency pattern and the microsatellite network of E-M2(xM191) indicate a West African origin followed by expansion, a result that is in agreement with the findings of Cruciani et al. Dulik MC, Osipova LP, Schurr TG : Y-chromosome variation in Altaian Kazakhs reveals a common paternal gene pool for Kazakhs and the influence of Mongolian expansions. (2000) suggested 17,000 years ago. Haplogroup G, together with J2 clades, has been associated with the spread of agriculture, especially in the European context. G-P16 is also occasionally present in Northeast Caucasus at lower frequencies (Supplementary Table S1), consistent with a previous report.3 Outside the Caucasus, hg G-P16 occurs at 1% frequency only in Anatolia, Armenia, Russia and Spain, while being essentially absent elsewhere. In human genetics, Haplogroup G-P303 ( G2a2b2a, [2] formerly G2a3b1) is a Y-chromosome haplogroup. The authors of the Spanish study indicated that the Avellaner men had rare marker values in testing of their short tandem repeat (STR) markers. We emphasize that our assessments are based solely on contemporary DNA distributions rather than actual prehistoric patterns. Differential Y-chromosome Anatolian influences on the Greek and Cretan Neolithic. It has been found in Mexican mestizos. There are seeming pockets of unusual concentrations within Europe. These five major sub-clades of the G2 branch show distinct distribution patterns over the whole area of their spread. Eur J Hum Genet 2010; 18: 348353. The M527-defined sub-clade is unusual in that it reflects the presence of hg G-U1 that is otherwise rare in Europe. Among Turkish males 11% of the population is G.[6] In Iran, Haplogroup G reaches 13 to 15% of the population in various parts of the country. G2a1a persons also typically have higher values for DYS385b, such as 16, 17 or 18, than seen in most G persons. Even more G SNPs were identified in 2009 to 2012 leading to more changes. [2], In 2012, a paper by Siiri Rootsi et al. Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF : New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree. Thus, G2a3a-M406, along with other lineages, such as J2a3b1-M92 and J2a4h2-DYS445=616, may track the expansion of the Neolithic from Central/Mediterranean Anatolia to Greece/Italy and Iran. Also for P15* and L91 lineages Td estimates, DYS19 was excluded owing to duplications in these lineages.36. The highest percentage of G-P303 persons in a discrete population so far described is on the island of Ibiza off the eastern Spanish coast. The P303 SNP defines the most frequent and widespread G sub-haplogroup. [16] The concentration of G falls below this average in Scandinavia, the westernmost former Soviet republics and Poland, as well as in Iceland and the British Isles. Thus, these estimates should be viewed as the upper bounds of dispersal times. The first principal component separates the populations of the Caucasus from those of Europe, with the Near/Middle Eastern populations being intermediate (Figure 3a). The most detailed SNP mutation identified was S126 (L30), which defines G2a3.[11]. No labs have yet assigned them shorthand names.